Journal: Frontiers in Immunology

Article Title: Mutation of the glycine residue preceding the sixth tyrosine of the LAT adaptor severely alters T cell development and activation

doi: 10.3389/fimmu.2022.1054920

Figure Lengend Snippet: Thymic development analysis of LAT G135D mice. (A) Total thymocytes from wild-type (LAT +/+ ), heterozygous (LAT +/G135D ) and homozygous (LAT G135D/G135D ) mutant mice were analyzed for the expression of CD4 and CD8 (upper panels) by flow cytometry. The numbers indicated in each gate represent the percentage of cells. Upper panels show a representative experiment. Lower panels represent bar graphs obtained after the analysis of LAT +/+ (n = 15), LAT +/G135D (n = 9) and LAT G135D/G135D (n = 13) mice, showing the percentages of cells in each of the indicated compartments. The brackets on each bar represent the mean standard error. (B) Dot plots showing CD5 and CD3 expression in DP cells from 6 to 14 weeks old wild-type (LAT +/+ , n = 13), heterozygous (LAT +/G135D , n = 8) and homozygous (LAT G135D/G135D , n = 12) mice. Lower panels represent the quantification of percentages of preselection DP cells (DP1), DP cells undergoing selection (DP2), and post selection DP thymocytes (DP3). * indicates p<0.05; ** indicates p<0.01. (C) Analysis of TCR signaling in thymocytes. 5 x 10 6 fresh thymocytes were obtained from wild-type (LAT +/+ ) and homozygous (LAT G135D/G135D ) mutant mice and incubated with the indicated concentrations of biotin-conjugated anti-CD3 for 30 min, and then stimulated with 10 µg/ml of streptavidin for 3 min at 37°C. Cells were then lysed and analyzed by Western blot with the indicated specific antibodies. Membranes were stripped and reanalyzed with antibodies β-actin to show total protein load. Numbers below the images represent the densitometric quantification of each band.

Article Snippet: The 110 nucleotides-long Lat G135D HDR template (5’-CAGAGCCAGCCTGTAAGAATGTGGATGCAGATGAGGATGAAGACGACTATCCCAACG A CTACCTGTGAGTGGGTAGAGGGGAGGTGACCGTGGAAGTTGTGTGCCCTTTA-3’, the mutated basis is underlined) was synthesized as a ssDNA and purified using polyacrylamide gel electrophoresis (BiOligo, Shanghai, China).

Techniques: Mutagenesis, Expressing, Flow Cytometry, Selection, Incubation, Western Blot

Journal: Frontiers in Immunology

Article Title: Mutation of the glycine residue preceding the sixth tyrosine of the LAT adaptor severely alters T cell development and activation

doi: 10.3389/fimmu.2022.1054920

Figure Lengend Snippet: Peripheral lymphocyte populations are altered by the LAT-G135D mutation. (A) CD4 and CD8 expression was analyzed in splenocytes from wild-type (LAT +/+ ), heterozygous (LAT +/G135D ), and homozygous (LAT G135D/G135D ) mutant mice (upper panels) by flow cytometry. The numbers indicated in each quadrant represent the percentage of cells. Upper panels show a representative experiment. Lower bar graph represents the average of the indicated populations after the analysis of LAT +/+ (n = 14), LAT +/G135D (n = 9), and LAT G135D/G135D (n = 13) mice. The brackets on each bar represent the mean standard error. (B) Dot plots showing CD3 and TCR-γδ expression in splenocytes cells from the indicated types of mice. The bar graph on the right shows the percentages of γδ-T cells in each mouse type: n = 13 for LAT +/+ , n = 9 for LAT +/G135D , and n = 11 for LAT G135D/G135D . (C) Analysis of memory and naive CD4 (upper dot plots) and CD8 (lower dot plots) T cells in spleen from wild-type (LAT +/+ ), heterozygous (LAT +/G135D ), and homozygous (LAT G135D/G135D ) mutant mice. The numbers in the depicted regions represent the percentage of cells.

Article Snippet: The 110 nucleotides-long Lat G135D HDR template (5’-CAGAGCCAGCCTGTAAGAATGTGGATGCAGATGAGGATGAAGACGACTATCCCAACG A CTACCTGTGAGTGGGTAGAGGGGAGGTGACCGTGGAAGTTGTGTGCCCTTTA-3’, the mutated basis is underlined) was synthesized as a ssDNA and purified using polyacrylamide gel electrophoresis (BiOligo, Shanghai, China).

Techniques: Mutagenesis, Expressing, Flow Cytometry

Journal: Frontiers in Immunology

Article Title: Mutation of the glycine residue preceding the sixth tyrosine of the LAT adaptor severely alters T cell development and activation

doi: 10.3389/fimmu.2022.1054920

Figure Lengend Snippet: LAT G135D mutation increases the percentage of anergic T cells. Splenocytes from the indicated types of mice were stained with CD4 and CD25 specific monoclonal antibodies (upper dot plots). The numbers indicated in each gate represent the percentage of CD4 + CD25 - and CD4 + CD25 + cells. Middle panels: CD4 + CD25 - cells were analyzed for the expression of CD73 and FR4, and the percentage of anergic T cells is indicated. Lower bar graphs: average of the indicated populations after the analysis of LAT +/+ (n = 13), LAT +/G135D (n = 8) and LAT G135D/G135D (n = 12) mice. The brackets on each bar represent the mean standard error. * indicates p<0.05.

Article Snippet: The 110 nucleotides-long Lat G135D HDR template (5’-CAGAGCCAGCCTGTAAGAATGTGGATGCAGATGAGGATGAAGACGACTATCCCAACG A CTACCTGTGAGTGGGTAGAGGGGAGGTGACCGTGGAAGTTGTGTGCCCTTTA-3’, the mutated basis is underlined) was synthesized as a ssDNA and purified using polyacrylamide gel electrophoresis (BiOligo, Shanghai, China).

Techniques: Mutagenesis, Staining, Bioprocessing, Expressing

Journal: Frontiers in Immunology

Article Title: Mutation of the glycine residue preceding the sixth tyrosine of the LAT adaptor severely alters T cell development and activation

doi: 10.3389/fimmu.2022.1054920

Figure Lengend Snippet: Ex vivo stimulation assays. (A) T cells purified from the spleens of wild-type LAT (LAT +/+ ) and homozygous (LAT G135D/G135D ) mutant mice were stimulated with the indicated bead:cell ratios of anti-CD3/CD28 microbeads, and analysis of CD69 surface expression 24H post-stimulation was performed on live cells (Annexin V negative). CD69 expression in CD4+ and CD8+ cell populations are shown separately. The numbers indicated in each histogram represent the percentage of CD69 positive cells (red histograms). Blue histograms show CD69 expression in unstimulated cells. One representative experiment is shown (n=3). (B) Analysis of proliferation performed at 72H post-stimulation. Decrease of CTV staining indicates cell proliferation. Blue histograms correspond to unstimulated cells and red histograms to anti-CD3/CD28 stimulated cells. Proliferative capacity was analyzed separately in CD4+ and CD8+ cell populations. The numbers shown in each histogram represent the percentage of cells that have proliferated. One representative experiment is shown (n=3).

Article Snippet: The 110 nucleotides-long Lat G135D HDR template (5’-CAGAGCCAGCCTGTAAGAATGTGGATGCAGATGAGGATGAAGACGACTATCCCAACG A CTACCTGTGAGTGGGTAGAGGGGAGGTGACCGTGGAAGTTGTGTGCCCTTTA-3’, the mutated basis is underlined) was synthesized as a ssDNA and purified using polyacrylamide gel electrophoresis (BiOligo, Shanghai, China).

Techniques: Ex Vivo, Purification, Mutagenesis, Expressing, Staining

Journal: Nucleic acids research

Article Title: CRISPR-Cas9-mediated nuclear transport and genomic integration of nanostructured genes in human primary cells.

doi: 10.1093/nar/gkac049

Figure Lengend Snippet: Figure 2. Nuclear localization and genome integration of nanostructured DNA. (A) Schematic of experimental approach: 0.5 pmol of each template either was transfected with 500 ng Cas9 nuclease expression plasmid along with 150 ng of sgRNA expressing plasmid or electroporated with 57.2 nmol of Cas9 RNPs. Genomic integration was assessed via flow cytometry after 7 days. (B) (i) Flow cytometry data measuring mNeonGreen+ cells (GFP+) show that looped templates are more efficiently incorporated into the genome compared to unstructured and 18-helix nanostructures. (ii) Flow cytometry of electroporated cells shows similar values across unstructured, looped and 18-helix nanostructures. (C) Aggregated flow cytometry data show that looped templates perform best for both transfection and electroporation. Error bars represent standard deviations (SDs) from three experiments, **P < 0.01, one-way ANOVA. (D) PCR using primers flanking the insertion site confirms mNeonGreen insertion at the target site (right triangle). (E) AFM images of the 18-helix nanostructure before and after electroporation. Scale bar: 100 nm.

Article Snippet: Nanostructured DNA comprising a human gene enhances human primary cell HDR compared to unstructured dsDNA. (A) Schematic of knock-in strategy of a 3.5-kb HDR template encoding IL2RA–GFP fusion and mCherry driven by an EF1a promoter. (B) oxDNA simulations and AFM images of four distinct versions of 18-helix DNA nanostructured HDR templates, including 50% Staples, Only Top, Open and Complex.

Techniques: Transfection, Expressing, Plasmid Preparation, Flow Cytometry, Electroporation

Journal: Nucleic acids research

Article Title: CRISPR-Cas9-mediated nuclear transport and genomic integration of nanostructured genes in human primary cells.

doi: 10.1093/nar/gkac049

Figure Lengend Snippet: Figure 4. Nanostructured DNA comprising a human gene enhances human primary cell HDR compared to unstructured dsDNA. (A) Schematic of knock-in strategy of a 3.5-kb HDR template encoding IL2RA–GFP fusion and mCherry driven by an EF1a promoter. (B) oxDNA simulations and AFM images of four distinct versions of 18-helix DNA nanostructured HDR templates, including 50% Staples, Only Top, Open and Complex. Scale bar: 100 nm. (C) Unstructured ssDNA and 18-helix nanostructure templates show increased knock-in efficiency compared to dsDNA. Error bars represent SDs from duplicate experiments. (D) Live cell count shows that unstructured ssDNA and 18-helix nanostructured templates display lower toxicity compared to dsDNA. Error bars represent SDs from duplicate experiments.

Article Snippet: Nanostructured DNA comprising a human gene enhances human primary cell HDR compared to unstructured dsDNA. (A) Schematic of knock-in strategy of a 3.5-kb HDR template encoding IL2RA–GFP fusion and mCherry driven by an EF1a promoter. (B) oxDNA simulations and AFM images of four distinct versions of 18-helix DNA nanostructured HDR templates, including 50% Staples, Only Top, Open and Complex.

Techniques: Knock-In, Cell Counting

Journal: Nucleic acids research

Article Title: CRISPR-Cas9-mediated nuclear transport and genomic integration of nanostructured genes in human primary cells.

doi: 10.1093/nar/gkac049

Figure Lengend Snippet: Figure 5. VLPs enable intracellular delivery of nanostructured DNA. (A) Schematic of experimental setup where successful incorporation of HDR tem- plates results in mNeonGreen+ cells. (B) Knock-in efficiencies of unstructured, looped and 18-helix nanostructures show comparable values for delivery using electroporation. Error bars represent SDs from duplicate experiments. (C) Cas9-VLP delivery shows that 18-helix nanostructured templates display a 2.5-fold higher knock-in efficiency compared to unstructured and looped templates. Error bars represent SDs from duplicate experiments, **P < 0.01, one-way ANOVA.

Article Snippet: Nanostructured DNA comprising a human gene enhances human primary cell HDR compared to unstructured dsDNA. (A) Schematic of knock-in strategy of a 3.5-kb HDR template encoding IL2RA–GFP fusion and mCherry driven by an EF1a promoter. (B) oxDNA simulations and AFM images of four distinct versions of 18-helix DNA nanostructured HDR templates, including 50% Staples, Only Top, Open and Complex.

Techniques: Knock-In, Electroporation